prk5-MFSD12-TEV-3xFLAG-3xHA
(Plasmid
#149504)
-
PurposeTransient expression of human MFSD12 with recoded nucleotide sequence.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149504 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneprk5
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression ; Transient Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMFSD12
-
Alt nameC19orf28
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1440
-
MutationCodon Optimized Sequence
-
Entrez GeneMFSD12 (a.k.a. C19orf28, PP3501)
- Promoter CMV
-
Tag
/ Fusion Protein
- TEV-3XHA-3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACGATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
prk5-MFSD12-TEV-3xFLAG-3xHA was a gift from David Sabatini (Addgene plasmid # 149504 ; http://n2t.net/addgene:149504 ; RRID:Addgene_149504) -
For your References section:
MFSD12 mediates the import of cysteine into melanosomes and lysosomes. Adelmann CH, Traunbauer AK, Chen B, Condon KJ, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nature. 2020 Nov 18. pii: 10.1038/s41586-020-2937-x. doi: 10.1038/s41586-020-2937-x. 10.1038/s41586-020-2937-x PubMed 33208952