pLDLR-Luc mutSRE
(Plasmid #14945)

• Depositing Lab: Axel Nohturfft
• Publication: Castoreno et al Proc Natl Acad Sci U S A. 2005 Sep 13. 102(37):13129-34.

Backbone

• Vector backbone: pGL2 basic
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5597
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LDLR promoter mut SRE
• Alt name: LDL receptor promoter
• Alt name: LDL receptor
• Species: H. sapiens (human)
• Insert Size (bp): 340
• Mutation: Point mutation in the SRE-1 sequence of the LDL receptor promoter (ATCACCCCAC changed to ATAACCCCAC)
• GenBank ID: NC_000019
• Entrez Gene: LDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: n/a
• 3′ sequencing primer: LucNrev

Resource Information

• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaaactcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCTTCACC -3'