pTCO2-mTDGi.1
(Plasmid
#149430)
-
PurposeminiTdg gene, catalytic mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTCO2 (Addgene Plasmid #149428)
-
Backbone manufacturerPrimo Schär Lab
- Backbone size w/o insert (bp) 13769
- Total vector size (bp) 15673
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTdg
-
Alt nameminiTdg gene
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1945
-
MutationN151A catalytic mutant, SNPs of Tdg gene in OLA/129 strain
-
GenBank IDNM_172552.4 NM_011561.3
-
Entrez GeneTdg (a.k.a. E130317C12Rik, JZA-3, Jza, Jza1)
- Promoter Tdg promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer AGCAGCGTGGGAGGGG
- 3′ sequencing primer TCCGTCCTGAGGTCTGCATTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTCO2-mTDGi.1 was a gift from Primo Schaer (Addgene plasmid # 149430 ; http://n2t.net/addgene:149430 ; RRID:Addgene_149430) -
For your References section:
Inducible TDG knockout models to study epigenetic regulation. Schwarz SD, Grundbacher E, Hrovat AM, Xu J, Kusnierczyk A, Vagbo CB, Schar P, Schuermann D. F1000Res. 2020 Sep 9;9:1112. doi: 10.12688/f1000research.25637.2. eCollection 2020. 10.12688/f1000research.25637.2 PubMed 33082936