-
PurposeHepatocyte-specific expression of ER-localized TurboID, N-term HA tag, C-term V5 tag, in AAV expression plasmid. Amp selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAV
- Total vector size (bp) 6019
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameER-TurboID
-
Insert Size (bp)1113
- Promoter TBG
-
Tags
/ Fusion Proteins
- V5 (C terminal on insert)
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aaactgggcttgtcgagaca
- 3′ sequencing primer gcagcgtatccacatag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TBG-ER-TurboID was a gift from Jonathan Long (Addgene plasmid # 149415 ; http://n2t.net/addgene:149415 ; RRID:Addgene_149415) -
For your References section:
Cell type-selective secretome profiling in vivo. Wei W, Riley NM, Yang AC, Kim JT, Terrell SM, Li VL, Garcia-Contreras M, Bertozzi CR, Long JZ. Nat Chem Biol. 2021 Mar;17(3):326-334. doi: 10.1038/s41589-020-00698-y. Epub 2020 Nov 16. 10.1038/s41589-020-00698-y PubMed 33199915