Cas9-sgRNA-A+B
(Plasmid #149370)

• Purpose: Expresses SpCas9 and two sgRNA targeting the lenti-CDDR reporter at two distal sites
• Depositing Lab: Tarek Abbas
• Publication: Eki et al Nucleic Acids Res. 2020 Oct 17. pii: 5929239. doi: 10.1093/nar/gkaa897.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: S. pyogenes Cas9
• Insert Size (bp): 4507
• Promoter: CBh
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • SV40 NLS (N terminal on insert)
  • Nucleoplasmin NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Gene/Insert 2

• Gene/Insert name: sgRNA-A
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: hU6-F

Gene/Insert 3

• Gene/Insert name: sgRNA-B
• Insert Size (bp): 102
• Promoter: U6

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: hU6-F

Gene/Insert 4

• Gene/Insert name: Puromycin resistance
• Alt name: PuroR
• Insert Size (bp): 600
• Promoter: PGK

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cattctgcacgcttcaaaag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry