Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFCIV-CEACAM6
(Plasmid #149303)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149303 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PFCIV
  • Backbone manufacturer
    Hope Center for Neurological Disorders
  • Backbone size w/o insert (bp) 10550
  • Total vector size (bp) 11558
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Bleo

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3 Genotype: F-mcrB mrrhsdS20(rB-, mB-) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20(StrR) xyl-5 λ-leumtl-1
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CEACAM6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1035
  • Entrez Gene
    CEACAM6 (a.k.a. CD66c, CEAL, NCA)
  • Promoter ubiquitin C

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGGACCCCCCTCAGCCCCTCCCTGCA
  • 3′ sequencing primer TTATATCAGAGCCACCCTGGCCA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the CEACAM6 gene was cloned from pRC202454 (OriGene)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

the pFCIV vector was obtained from the Hope Center at Washington University. https://hopecenter.wustl.edu/?page_id=7068 PMC5008082

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFCIV-CEACAM6 was a gift from James Fleckenstein (Addgene plasmid # 149303 ; http://n2t.net/addgene:149303 ; RRID:Addgene_149303)
  • For your References section:

    CEACAMs serve as toxin-stimulated receptors for enterotoxigenic Escherichia coli. Sheikh A, Tumala B, Vickers TJ, Alvarado D, Ciorba MA, Bhuiyan TR, Qadri F, Singer BB, Fleckenstein JM. Proc Natl Acad Sci U S A. 2020 Nov 17;117(46):29055-29062. doi: 10.1073/pnas.2012480117. Epub 2020 Nov 2. 10.1073/pnas.2012480117 PubMed 33139570