FCK-hCmC
(Plasmid
#14897)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 14897 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFCK(1.3)GW
-
Backbone manufacturerPavel Osten
- Backbone size w/o insert (bp) 9250
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli (e.g., Invitrogen's Stbl3)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChR2
-
Alt nameChannelrhodopsin-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1650
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer atgactgagaccctcccacccgtgactgaaagcgccgt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Created with Dr. Karl Deisseroth at Stanford.
Channelrhodopsin-2/ChR2, with humanized/mammalian optimized codon usage, fused with mCherry (FCK-hCmC), containing hChR2-mCherry. Please note that the mCherry signal is faint.
For more information, see http://channelrhodopsin.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FCK-hCmC was a gift from Edward Boyden (Addgene plasmid # 14897)