pmKalama1-Nuc
(Plasmid #14894)

• Purpose: Mammalian expression of mKalama1 blue fluorescent protein with NLS
• Depositing Lab: Robert Campbell
• Publication: Ai et al Biochemistry. 2007 Apr 20. ():.

Backbone

• Vector backbone: pEYFP-Nuc
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pmKalama1-Nuc
• Alt name: mKalama1 blue fluorescent protein with NLS
• Species: evolved fluorescent protein
• Insert Size (bp): 720
• Mutation: I178T mismatch, replace EYFP of the vector pEYFP-Nuc from Clontech with mKalama1.
• GenBank ID: EF517317
• Tag / Fusion Protein:
  • NLS (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry