Hmga2 3'UTR m2 luciferase (Luc-m2)
(Plasmid #14786)

• Depositing Lab: David Bartel
• Publication: Mayr et al Science. 2007 Mar 16. 315(5818):1576-9.

Backbone

• Vector backbone: pIS1
• Backbone manufacturer: Available from Addgene (#12179)
• Backbone size w/o insert (bp): 4000
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Luc-m2
• Alt name: HMGA2
• Species: M. musculus (mouse)
• Insert Size (bp): 3000
• Mutation: m2 mutant (see article and author's map for details)
• GenBank ID: BC052158
• Entrez Gene: Hmga2 (a.k.a. 9430083A20Rik, HMGI-C, Hmgic, pg, pygmy)
• Tag / Fusion Protein:
  • luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: N/A
• 3′ sequencing primer: EBV rev primer

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

Full sequence of wild-type plasmid available at Addgene plasmid #14785.