Rev CDK9 (D167N) (P#858)
(Plasmid #14635)

• Depositing Lab: Matija Peterlin
• Publication: Fujinaga et al J Virol. 1998 Sep . 72(9):7154-9.

Backbone

• Vector backbone: pSPORT-Rev
• Backbone size w/o insert (bp): 4200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cdk9 D167N
• Alt name: cyclin dependent kinase 9
• Alt name: cdk9
• Species: H. sapiens (human)
• Insert Size (bp): 1100
• Mutation: D167N. Kinase negative mutant.
• Entrez Gene: CDK9 (a.k.a. C-2k, CDC2L4, CTK1, PITALRE, TAK)
• Tag / Fusion Protein:
  • Rev (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: SP6
• 3′ sequencing primer: T7

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To construct pSPORTRev, Rev coding sequences (350 bp) were amplified by PCR from pcRev, restricted with AflII and SacI, and cloned into the PstI and SacI sites of pSV · SPORT 1 (Gibco BRL, Gaithersburg, Md.), which contains modified polylinker sequences .

CDK9 (D167N) was amplified by PCR from pRc/CMVCDK9D-NHA [pCDK9(D167N) with the oligonucleotides 5' GCGATCcagctgGAGGCGGCCATGGCAAAGCAGTACGACTCGGT 3' (lowercase letters indicate the PvuII site) and 5' CAGACGGAGTTTGAGCGCGTCTTCCTCGAGAGGGGCCGGCG 3'. Amplified products (1.1 kbp) were restricted with PvuII and subcloned into pSPORTRev (PvuII).