Skip to main content
Addgene

pCIS-rPALcc
(Plasmid #145804)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145804 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCIS
  • Backbone manufacturer
    Cornelia Gorman
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat PALcc (peptidyl-hydroxyglycine alpha-amidating monooxygenase)
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1350
  • Mutation
    changed serine 767 to alanine to prevent glycosylation
  • Entrez Gene
    Pam (a.k.a. PHM)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind3 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer CTTGAGGTGTGGCAGGCTTG
  • 3′ sequencing primer TGGTGTTGATCTTACGTCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIS-rPALcc was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145804 ; http://n2t.net/addgene:145804 ; RRID:Addgene_145804)
  • For your References section:

    Essential features of the catalytic core of peptidyl-alpha-hydroxyglycine alpha-amidating lyase. Kolhekar AS, Bell J, Shiozaki EN, Jin L, Keutmann HT, Hand TA, Mains RE, Eipper BA. Biochemistry. 2002 Oct 15;41(41):12384-94. doi: 10.1021/bi0260280. 10.1021/bi0260280 PubMed 12369828