Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SG3ΔENV CA Q63A,Q67A
(Plasmid #145784)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145784 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTZ19U
  • Backbone manufacturer
    Bio-Rad
  • Backbone size w/o insert (bp) 2863
  • Total vector size (bp) 14788
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression, Lentiviral, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Recombination deficient strain required to avoid recombination of plasmid
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Capsid
  • Alt name
    CA
  • Species
    HIV-1
  • Mutation
    Changed Capsid residues Glutamines 63 and 67 to alanines (CA Q63A,Q67A)
  • GenBank ID
    L02317.1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BssHII (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer GCTTGCTGAAGCGCGCAC
  • 3′ sequencing primer GAAGGGTACTAGTAGTTCCTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloned from NIH Aids reagent program plasmid SG3delENV catalog #11051

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SG3ΔENV CA Q63A,Q67A was a gift from Wesley Sundquist (Addgene plasmid # 145784 ; http://n2t.net/addgene:145784 ; RRID:Addgene_145784)
  • For your References section:

    Reconstitution and visualization of HIV-1 capsid-dependent replication and integration in vitro. Christensen DE, Ganser-Pornillos BK, Johnson JS, Pornillos O, Sundquist WI. Science. 2020 Oct 9;370(6513). pii: 370/6513/eabc8420. doi: 10.1126/science.abc8420. 10.1126/science.abc8420 PubMed 33033190