SG3ΔENV CA E45A
(Plasmid #145783)

• Purpose: Non-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and E45A mutation in capsid (CA E45A).
• Depositing Lab: Wesley Sundquist
• Publication: Christensen et al Science. 2020 Oct 9;370(6513). pii: 370/6513/eabc8420. doi: 10.1126/science.abc8420.

Backbone

• Vector backbone: pTZ19U
• Backbone manufacturer: Bio-Rad
• Backbone size w/o insert (bp): 2863
• Total vector size (bp): 14788
• Modifications to backbone: none
• Vector type: Mammalian Expression, Lentiviral, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Recombination deficient strain required to avoid recombination of plasmid
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Capsid
• Alt name: CA
• Species: HIV-1
• Mutation: Changed Capsid residue glutamic acid 45 to alanine (CA E45A)
• GenBank ID: L02317.1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BssHII (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: GCTTGCTGAAGCGCGCAC
• 3′ sequencing primer: GAAGGGTACTAGTAGTTCCTG

Resource Information

• Supplemental Documents:
  • pSG3.1delENV CA E45A.gb
• A portion of this plasmid was derived from a plasmid made by: Cloned from NIH Aids reagent program plasmid SG3delENV catalog #11051

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid may be unstable in E. coli. It is recommended to screen multiple DNA preps by a diagnostic digest.