SG3ΔENV RT D185A
(Plasmid #145782)

• Purpose: Non-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and D185A mutation in reverse transcriptase (RT D185A).
• Depositing Lab: Wesley Sundquist
• Publication: Christensen et al Science. 2020 Oct 9;370(6513). pii: 370/6513/eabc8420. doi: 10.1126/science.abc8420.

Backbone

• Vector backbone: pTZ19U
• Backbone manufacturer: Bio-Rad
• Backbone size w/o insert (bp): 2863
• Total vector size (bp): 14788
• Modifications to backbone: none
• Vector type: Mammalian Expression, Lentiviral, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Recombination deficient strain required to avoid recombination of plasmid
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Reverse Transcriptase
• Alt name: RT
• Species: HIV-1
• Mutation: Changed Reverse Transcriptase Aspartic Acid 185 to Alanine (D185A)
• GenBank ID: L02317.1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: PfiMI (not destroyed)
• 5′ sequencing primer: CCATTAGTCCTATTGAAACTGTA
• 3′ sequencing primer: CATAATACACTCCATGTACTGG

Resource Information

• Supplemental Documents:
  • pSG3.1delENV RT D185A.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Cloned from NIH Aids reagent program plasmid SG3delENV catalog #11051

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

LTR containing constructs are prone to recombination. Please screen clones by digest prior to experimental.