Skip to main content
Addgene

RCASBP(A)-3xFlag-mHoxd13+7Ala
(Plasmid #145289)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145289 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    RCASBP(A)
  • Vector type
    Viral Avian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Hoxd13(+7Ala)
  • Alt name
    Hoxd13(spdh)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1169
  • Mutation
    A-repeat expanded
  • Entrez Gene
    Hoxd13 (a.k.a. Hox-4.8, spdh)
  • Tag / Fusion Protein
    • 3xFlag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site SpeI (unknown if destroyed)
  • 5′ sequencing primer gagctgagctgactctgctggtgg
  • 3′ sequencing primer tcaggagacagtgtctttgagcttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RCASBP(A)-3xFlag-mHoxd13+7Ala was a gift from Denes Hnisz (Addgene plasmid # 145289 ; http://n2t.net/addgene:145289 ; RRID:Addgene_145289)
  • For your References section:

    Unblending of Transcriptional Condensates in Human Repeat Expansion Disease. Basu S, Mackowiak SD, Niskanen H, Knezevic D, Asimi V, Grosswendt S, Geertsema H, Ali S, Jerkovic I, Ewers H, Mundlos S, Meissner A, Ibrahim DM, Hnisz D. Cell. 2020 May 28;181(5):1062-1079.e30. doi: 10.1016/j.cell.2020.04.018. Epub 2020 May 7. 10.1016/j.cell.2020.04.018 PubMed 32386547