Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EGFP-CCHD (p130Cas)
(Plasmid #145132)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145132 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    EGFP
  • Total vector size (bp) 5172
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p130Cas CCH domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    483
  • Entrez Gene
    BCAR1 (a.k.a. CAS, CAS1, CASS1, CRKAS, P130Cas)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer GGCTGATTATGATCAGTTATCTAGATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-CCHD (p130Cas) was a gift from Johanna Ivaska (Addgene plasmid # 145132 ; http://n2t.net/addgene:145132 ; RRID:Addgene_145132)
  • For your References section:

    Filopodome Mapping Identifies p130Cas as a Mechanosensitive Regulator of Filopodia Stability. Jacquemet G, Stubb A, Saup R, Miihkinen M, Kremneva E, Hamidi H, Ivaska J. Curr Biol. 2019 Jan 21;29(2):202-216.e7. doi: 10.1016/j.cub.2018.11.053. Epub 2019 Jan 10. 10.1016/j.cub.2018.11.053 PubMed 30639111