pAG30 IQGAP1 3'UTR mut
(Plasmid #14504)

• Depositing Lab: David Bartel
• Publication: Lim et al Nature. 2005 Feb 17. 433(7027):769-73.

Backbone

• Vector backbone: pIS2
• Backbone manufacturer: pIS2 derived from pRL-SV40 (Promega)
• Backbone size w/o insert (bp): 3700
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IQGAP1 3'UTR mutant
• Alt name: IQGAP1
• Species: H. sapiens (human)
• Insert Size (bp): 820
• Mutation: GTGCCTT was changed to GTGCGCC and GTGCCT was changed to GTCGGT
• Entrez Gene: IQGAP1 (a.k.a. HUMORFA01, SAR1, p195)
• Tag / Fusion Protein:
  • luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IQGAP1 3'UTR mutant in renilla luciferase reporter plasmid. There are several sequence discrepancies between Addgene's quality control sequence and depositor's sequence. Please refer to the Addgene sequence for the correct mutations.