-
PurposepET vector for IPTG-inducible, T7-based expression of the exonuclease deficient version of RTX bearing a C-terminal 6xHis tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemodified pET21
- Backbone size w/o insert (bp) 5871
- Total vector size (bp) 8232
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRTX(exo-)
-
Alt nameExonuclease deficient variant of RTX
-
SpeciesSynthetic
-
Insert Size (bp)2361
-
MutationN210D
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GATCTCGATCCCGCGAAATTAATACGAC
- 3′ sequencing primer TTGCTCAGCGGTGGCAGCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJared Ellefson (Ellington Lab)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.03.29.013342 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET_RTX(exo-)-6xHis was a gift from Andrew Ellington (Addgene plasmid # 145028 ; http://n2t.net/addgene:145028 ; RRID:Addgene_145028) -
For your References section:
A one-enzyme RT-qPCR assay for SARS-CoV-2, and procedures for reagent production. Bhadra S, Maranhao AC, Paik I, Ellington AD. BioProtocol 2021 10.21769/BioProtoc.3898