TFORF3355
(Plasmid #144831)

• Purpose: Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.
• Depositing Lab: Feng Zhang
• Publication: Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi: 10.1016/j.cell.2022.11.026.

Backbone

• Vector backbone: pLX_TRC317
• Backbone manufacturer: Broad Institute Genetic Perturbation Platform
• Backbone size w/o insert (bp): 8264
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FOXN2
• Species: H. sapiens (human)
• Insert Size (bp): 1499
• Entrez Gene: FOXN2 (a.k.a. HTLF)
• Promoter: EF1a
• Tag / Fusion Protein:
  • V5 (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GGGTGGAGACTGAAGTTAGGCCAG
• 3′ sequencing primer: CACATAGCGTAAAAGGAGCAACATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Broad Institute Genetic Perturbation Platform

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NM_002158.3 Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at prior to placing an order to request the full sequence.