pRU1101
(Plasmid
#14466)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 14466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepbbr
- Backbone size w/o insert (bp) 4500
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameunstable gfp-mut3.1 ASV
-
SpeciesAequorea
-
Insert Size (bp)717
-
GenBank IDaj851282
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer cggtttacaagcataaagc
- 3′ sequencing primer TACTCATTTTTTCTTCCTCCACTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use gentamicin at 10 ug/mL.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRU1101 was a gift from Philip Poole (Addgene plasmid # 14466 ; http://n2t.net/addgene:14466 ; RRID:Addgene_14466) -
For your References section:
A family of promoter probe vectors incorporating autofluorescent and chromogenic reporter proteins for studying gene expression in Gram-negative bacteria. Karunakaran R, Mauchline TH, Hosie AH, Poole PS. Microbiology. 2005 Oct . 151(Pt 10):3249-56. 10.1099/mic.0.28311-0 PubMed 16207908