TFORF1660
(Plasmid #142820)

• Purpose: Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.
• Depositing Lab: Feng Zhang
• Publication: Joung et al Cell. 2023 Jan 5;186(1):209-229.e26. doi: 10.1016/j.cell.2022.11.026.

Backbone

• Vector backbone: pLX_TRC317
• Backbone manufacturer: Broad Institute Genetic Perturbation Platform
• Backbone size w/o insert (bp): 8264
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LEF1
• Species: H. sapiens (human)
• Insert Size (bp): 1217
• Entrez Gene: LEF1 (a.k.a. LEF-1, TCF10, TCF1ALPHA, TCF7L3)
• Promoter: EF1a

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GGGTGGAGACTGAAGTTAGGCCAG
• 3′ sequencing primer: CACATAGCGTAAAAGGAGCAACATAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

NM_001130713,ENST00000438313 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at prior to placing an order to request the full sequence.