pMP71-BFP
(Plasmid
#141355)
-
PurposepMP71 expression vector containing BFP
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMP71
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5200
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametagBFP
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCTCCACAAAGTTAAGTAATAGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMP71-BFP was a gift from Ton Schumacher (Addgene plasmid # 141355 ; http://n2t.net/addgene:141355 ; RRID:Addgene_141355) -
For your References section:
A mouse model that is immunologically tolerant to reporter and modifier proteins. Bresser K, Dijkgraaf FE, Pritchard CEJ, Huijbers IJ, Song JY, Rohr JC, Scheeren FA, Schumacher TN. Commun Biol. 2020 May 29;3(1):273. doi: 10.1038/s42003-020-0979-0. 10.1038/s42003-020-0979-0 PubMed 32472011
