pVAX-Help-SIINFEKL
(Plasmid
#141350)
-
PurposeDNA vaccination plasmid containing SIINFEKL and several CD4+ T cell epitopes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepVAX
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 3300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHELP-SIINFEKL-KDEL
-
SpeciesSynthetic
-
Insert Size (bp)378
- Promoter CMV promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVAX-Help-SIINFEKL was a gift from Ton Schumacher (Addgene plasmid # 141350 ; http://n2t.net/addgene:141350 ; RRID:Addgene_141350) -
For your References section:
A mouse model that is immunologically tolerant to reporter and modifier proteins. Bresser K, Dijkgraaf FE, Pritchard CEJ, Huijbers IJ, Song JY, Rohr JC, Scheeren FA, Schumacher TN. Commun Biol. 2020 May 29;3(1):273. doi: 10.1038/s42003-020-0979-0. 10.1038/s42003-020-0979-0 PubMed 32472011