pET28a(+)::MBP-NL3F10H
(Plasmid #141291)

• Purpose: MBP:NLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)
• Depositing Lab: Andrew Millar
• Publication: Urquiza-Garcia et al Plant Methods. 2019 Jul 8;15:68. doi: 10.1186/s13007-019-0454-4. eCollection 2019.

Backbone

• Vector backbone: pET-28 a (+)
• Backbone manufacturer: EMD Biosciences
• Backbone size w/o insert (bp): 5369
• Total vector size (bp): 7075
• Vector type: Bacterial Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Kanamycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): BL21 DE3 Rossetta2 pLysS (Novagen, Merck, Darmstadt, Germany)
• Growth instructions: LB media with 50 µg/ml Kanamycin (Kn50) and 34 µg/ml Chloramphenicol (Cm34). Incubate the plate over-night at 37 °C. The chloramphenicol relates to the bacterial strain (E. coli BL21 DE3 Rossetta2 pLysS) and not the plasmid itself
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MBP-NLUC3F10H
• Alt name: NanoLuc
• Alt name: NanoLUC
• Alt name: NanoLuciferase
• Species: Synthetic; Oplophorus gracilirostris
• Insert Size (bp): 1800
• Mutation: Engineered for high stability (t1/2 = 11.5 days at 37 °C) and codon optimised for expression in mammalian cells.
• Promoter: promoter for bacteriophage T7 RNA polymerase
• Tags / Fusion Proteins:
  • Flag (x3) (C terminal on insert)
  • His (x10) (C terminal on insert)
  • MBP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Supplemental Documents:
  • pet28ambp-nl3f10h.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation (UK, Delta House, Southampton Science Park, Southampton, SO16 7NS). The NanoLUC sequence was amplified, and cloned via a pET28a(+) (Novagen, Merck, Darmstadt, Germany) intermediate vector into a pUC19 vector carrying a 3× FLAG 10× His peptide as a C-terminal translational fusion, to form NanoLUC-3× FLAG-10× His (NL3F10H). The 3× FLAG-10His was chemically synthesised by Eurogentec (Seraing, Belgium). The tagged NanoLUC was amplified and cloned using Gibson assembly into pET28a(+) resulting in pET28a(+)::NL3F10H. A N-terminal tag comprising Maltose Binding Protein 6× His was fused to NanoLUC-3F10H, by amplifying the MBP-6× His from pMJ806 [38], resulting in pET28a(+)::MBP-NL3F10H.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry