pGWB501NL3F10H
(Plasmid #141286)

• Purpose: (Empty Backbone) No promoter, C-terminal NLUC:3xFlag:10xHis tag, attR1-Cmr-ccdB-attR2-NLUC:3xFlag:3xHis-TNOS (modified pGWB401, pPZP backbone, SpcR for bacteria, HygR for plant)
• Depositing Lab: Andrew Millar
• Publication: Urquiza-Garcia et al Plant Methods. 2019 Jul 8;15:68. doi: 10.1186/s13007-019-0454-4. eCollection 2019.

Backbone

• Vector backbone: pGWB501
• Backbone manufacturer: Tsuyoshi Nakagawa
• Backbone size (bp): 11165
• Modifications to backbone: We created a series of vectors using the NL3F10H reporter instead of LUC+. This was achieved by amplifying a sub-fragment of the Gateway cassette and fusing it with NL3F10H and pGWB401 digested with NcoI/SacI by Gibson assembly.
• Vector type: Plant Expression, Luciferase ; Gateway
• Selectable markers: Hygromycin
• Tags / Fusion Proteins:
  • NLUC (C terminal on backbone)
  • FLAG (x3) (C terminal on backbone)
  • HIS (x10) (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TGTAAAACGACGGCCAGTGC
• 3′ sequencing primer: CCGCTCAGGACAATCCTTTGG

Resource Information

• Supplemental Documents:
  • pgwb501nl3f19h.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation (UK, Delta House, Southampton Science Park, Southampton, SO16 7NS) and propagated in E. coli DH5alpha (Invitrogen, ThermoFisher Scientific, Waltham, Massachusetts, US). The NanoLUC sequence was amplified, and cloned via a pET28a(+) (Novagen, Merck, Darmstadt, Germany) intermediate vector into a pUC19 vector carrying a 3× FLAG 10× His peptide as a C-terminal translational fusion, to form NanoLUC-3× FLAG-10× His (NL3F10H). The 3× FLAG-10His was chemically synthesised by Eurogentec (Seraing, Belgium).