Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
(Plasmid #141236)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141236 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-Ef1a-FAS-insert-WPRE-pA
  • Backbone manufacturer
    B. Sabatini Lab
  • Backbone size w/o insert (bp) 5142
  • Total vector size (bp) 6843
  • Vector type
    AAV, Cre/Lox ; Cre-Off

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-jRGECO1a
  • Alt name
    NES-R-GECO1.0 variant 1670
  • Insert Size (bp)
    1413
  • Promoter human elongation factor-1 alpha (EF-1 alpha)
  • Tags / Fusion Proteins
    • nuclear export signal (N terminal on insert)
    • 6xHIS tag (N terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer Ef1a-F, tcaagcctcagacagtggttc
  • 3′ sequencing primer WPRE-R, gcagcgtatccacatag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    NES-jRGECO1a was a gift from Douglas Kim & GENIE Project, Addgene 61563.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Sensitive red protein calcium indicators for imaging neural activity. Dana H, Mohar B, Sun Y, Narayan S, Gordus A, Hasseman JP, Tsegaye G, Holt GT, Hu A, Walpita D, Patel R, Macklin JJ, Bargmann CI, Ahrens MB, Schreiter ER, Jayaraman V, Looger LL, Svoboda K, Kim DS. Elife. 2016 Mar 24;5. pii: e12727. doi: 10.7554/eLife.12727.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE was a gift from Guohong Cui (Addgene plasmid # 141236 ; http://n2t.net/addgene:141236 ; RRID:Addgene_141236)
  • For your References section:

    Spectrally Resolved Fiber Photometry for Multi-component Analysis of Brain Circuits. Meng C, Zhou J, Papaneri A, Peddada T, Xu K, Cui G. Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3. 10.1016/j.neuron.2018.04.012 PubMed 29731250