Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Sec61b-HA-mNG21-10
(Plasmid #141213)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141213 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE-EF1a-shortEf1a-IRES-Blasticidin
  • Backbone size w/o insert (bp) 8300
  • Modifications to backbone
    derived from pHAGE-shortEf1a-IRES-ZsGreen from Harvard Medical School
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sec61b-HA-mNG21-10
  • Species
    Synthetic
  • Insert Size (bp)
    963
  • Tag / Fusion Protein
    • HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (unknown if destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer ATATAAGTGCAGTAGTCGCCG
  • 3′ sequencing primer ATATAGACAAACGCACACCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sec61b-HA-mNG21-10 was a gift from Wayne Lencer (Addgene plasmid # 141213 ; http://n2t.net/addgene:141213 ; RRID:Addgene_141213)
  • For your References section:

    A quantitative single-cell assay for retrograde membrane traffic enables rapid detection of defects in cellular organization. Luong P, Li Q, Chen PF, Wrighton PJ, Chang D, Dwyer S, Bayer MT, Snapper SB, Hansen SH, Thiagarajah JT, Goessling W, Lencer WI. Mol Biol Cell. 2019 Nov 27:mbcE19070375. doi: 10.1091/mbc.E19-07-0375. 10.1091/mbc.E19-07-0375 PubMed 31774722
Commonly requested with: