pARR5::LUC
(Plasmid #141170)

• Purpose: Luminescent reporter for cytokinin signaling
• Depositing Labs: Vardis Ntoukakis, Patrick Schäfer
• Publication: Lehmann et al PLoS One. 2020 Jun 4;15(6):e0234154. doi: 10.1371/journal.pone.0234154. eCollection 2020.

Backbone

• Vector backbone: pJS
• Backbone manufacturer: Jen Sheen, ABRC FRK1-LUC / CD3-919
• Backbone size w/o insert (bp): 4732
• Total vector size (bp): 6381
• Vector type: Plant Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AtARR5 promoter
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1649
• GenBank ID: AT3G48100
• Promoter: AtARR5, AT3G48100

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTTCCCAGTCACGAC
• 3′ sequencing primer: CTTATGCAGTTGCTCTCCAG

Resource Information

• Supplemental Documents:
  • pARR5_LUC.gb
• A portion of this plasmid was derived from a plasmid made by: We received the plasmid backbone by BamHI/NcoI restriction digest from FRK1-LUC (ABRC CD3-919, donated by Jen Sheen) and used it to insert the promoters by Gibson cloning.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

An extra T nucleotide was identified by both Sanger and Illumina NGS in the ARR5 compared to the genomic reference. Both sequencing technologies are prone to generating artifacts in the determination of long mononucleotide stretches and the difference, if not an artifact, is not known to impact the function of the plasmid.