pIAA5::LUC
(Plasmid
#141169)
-
PurposeLuminescent reporter for auxin signaling
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJS
-
Backbone manufacturerJen Sheen, ABRC FRK1-LUC / CD3-919
- Backbone size w/o insert (bp) 4732
- Total vector size (bp) 5654
-
Vector typePlant Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAtIAA5 promoter
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)922
-
GenBank IDAt1g15580
- Promoter AtIAA5, At1g15580
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTTCCCAGTCACGAC
- 3′ sequencing primer CTTATGCAGTTGCTCTCCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe received the plasmid backbone by BamHI/NcoI restriction digest from FRK1-LUC (ABRC CD3-919, donated by Jen Sheen) and used it to insert the promoters by Gibson cloning.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIAA5::LUC was a gift from Vardis Ntoukakis & Patrick Schäfer (Addgene plasmid # 141169 ; http://n2t.net/addgene:141169 ; RRID:Addgene_141169) -
For your References section:
Novel markers for high-throughput protoplast-based analyses of phytohormone signaling. Lehmann S, Dominguez-Ferreras A, Huang WJ, Denby K, Ntoukakis V, Schafer P. PLoS One. 2020 Jun 4;15(6):e0234154. doi: 10.1371/journal.pone.0234154. eCollection 2020. 10.1371/journal.pone.0234154 PubMed 32497144