pRAB18::LUC
(Plasmid #141168)

• Purpose: Luminescent reporter for abscisic acid signaling
• Depositing Labs: Vardis Ntoukakis, Patrick Schäfer
• Publication: Lehmann et al PLoS One. 2020 Jun 4;15(6):e0234154. doi: 10.1371/journal.pone.0234154. eCollection 2020.

Backbone

• Vector backbone: pJS
• Backbone manufacturer: Jen Sheen, ABRC FRK1-LUC / CD3-919
• Backbone size w/o insert (bp): 4732
• Total vector size (bp): 5380
• Vector type: Plant Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: AtRAB18 promoter
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 648
• GenBank ID: AT5G66400
• Promoter: AtRAB18, AT5G66400

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTTCCCAGTCACGAC
• 3′ sequencing primer: CTTATGCAGTTGCTCTCCAG

Resource Information

• Supplemental Documents:
  • pRAB18_LUC.gb
• A portion of this plasmid was derived from a plasmid made by: We received the plasmid backbone by BamHI/NcoI restriction digest from FRK1-LUC (ABRC CD3-919, donated by Jen Sheen) and used it to insert the promoters by Gibson cloning.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry