pGZ12.0501
(Plasmid
#141164)
-
PurposeTcTT2 in Ti plasmid binary vector pGZ12.0501 (KF871320.1)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141164 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGH00.0126
-
Backbone manufacturerGuiltinan Lab
- Backbone size w/o insert (bp) 16177
- Total vector size (bp) 17041
-
Vector typePlant Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTcTTC
-
SpeciesTheobroma cacao
-
Insert Size (bp)864
-
GenBank IDKF871320
- Promoter E12-omega
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer ATGGGGAGGGCTCCTTGC
- 3′ sequencing primer TTTGCCGAATCATTGCTCATCTAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYufan Zhang, Graduate student
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS result had a single bp mismatch on the IS1 element and few discrepancies on the traF [KF871320] region. The depositor confirmed that these discrepancies do not affect the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGZ12.0501 was a gift from Mark Guiltinan (Addgene plasmid # 141164 ; http://n2t.net/addgene:141164 ; RRID:Addgene_141164) -
For your References section:
Enhanced somatic embryogenesis in Theobroma cacao using the homologous BABY BOOM transcription factor. Florez SL, Erwin RL, Maximova SN, Guiltinan MJ, Curtis WR. BMC Plant Biol. 2015 May 16;15:121. doi: 10.1186/s12870-015-0479-4. 10.1186/s12870-015-0479-4 PubMed 25976599