Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Tn7 helper plasmid
(Plasmid #141161)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141161 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSC101 temperature-sensitive origin of replication
  • Backbone size w/o insert (bp) 5932
  • Total vector size (bp) 12042
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    temperature sensitive plasmid
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tn7 transposon machinery
  • Alt name
    tnsABCD
  • Species
    Tn7
  • Insert Size (bp)
    6110
  • Promoter Arabinose-inducible pBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer attgccgtcactgcgtcttttac
  • 3′ sequencing primer actgttaaccaccttagctcgac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jesse Lerner

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tn7 helper plasmid was a gift from Shimon Bershtein (Addgene plasmid # 141161 ; http://n2t.net/addgene:141161 ; RRID:Addgene_141161)
  • For your References section:

    Chromosomal barcoding of E. coli populations reveals lineage diversity dynamics at high resolution. Jasinska W, Manhart M, Lerner J, Gauthier L, Serohijos AWR, Bershtein S. Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z. 10.1038/s41559-020-1103-z PubMed 32094541