Tn7 helper plasmid
(Plasmid #141161)

• Purpose: Temperature-sensitive plasmid carries tnsABCD genes that encode transposase biochemical machinery under an arabinose-inducible pBAD promoter
• Depositing Lab: Shimon Bershtein
• Publication: Jasinska et al Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z.

Backbone

• Vector backbone: pSC101 temperature-sensitive origin of replication
• Backbone size w/o insert (bp): 5932
• Total vector size (bp): 12042
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: temperature sensitive plasmid
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tn7 transposon machinery
• Alt name: tnsABCD
• Species: Tn7
• Insert Size (bp): 6110
• Promoter: Arabinose-inducible pBAD

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: attgccgtcactgcgtcttttac
• 3′ sequencing primer: actgttaaccaccttagctcgac

Resource Information

• Supplemental Documents:
  • tn7-helper-plasmid.gb
• A portion of this plasmid was derived from a plasmid made by: Jesse Lerner

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry