C163
(Plasmid
#141127)
-
PurposeExpresses sfCFP under lac promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMB1
- Backbone size w/o insert (bp) 4566
- Total vector size (bp) 5280
-
Modifications to backboneROP element reducing copy number and spacer sequence
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfCFP
-
SpeciesSynthetic
-
Insert Size (bp)714
- Promoter engineered lac promoter
-
Tag
/ Fusion Protein
- ssrA degradation tag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gaacggtttcactaggaagcaag
- 3′ sequencing primer tatggatgcggcgggac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C163 was a gift from Matthew Bennett (Addgene plasmid # 141127 ; http://n2t.net/addgene:141127 ; RRID:Addgene_141127) -
For your References section:
Majority sensing in synthetic microbial consortia. Alnahhas RN, Sadeghpour M, Chen Y, Frey AA, Ott W, Josic K, Bennett MR. Nat Commun. 2020 Jul 21;11(1):3659. doi: 10.1038/s41467-020-17475-z. 10.1038/s41467-020-17475-z PubMed 32694598