Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RA35
(Plasmid #141126)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141126 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSC101
  • Backbone size w/o insert (bp) 6484
  • Total vector size (bp) 8280
  • Modifications to backbone
    spacer sequence between two inserts
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    dimeric LacI (LacI-11)
  • Species
    Synthetic
  • Insert Size (bp)
    1047
  • Mutation
    truncated/dimeric version of LacI (missing last 11 amino acids = tetramerization domain)
  • Entrez Gene
    lacI (a.k.a. b0345, ECK0342)
  • Promoter engineered rhl promoter (responds to C4-HSL)
  • Tag / Fusion Protein
    • ssrA degradation tag (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCCCAACCTTACCAGAGGGC
  • 3′ sequencing primer TTGCGGGCAACTTCAGCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AiiA
  • Insert Size (bp)
    749
  • Entrez Gene
    AQ980_RS12585 (a.k.a. AQ980_RS12585, AQ980_12820)
  • Promoter engineered xyl promoter (responds to xylose)
  • Tag / Fusion Protein
    • ssrA degradation tag (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gaacggtttcactaggaagcaag
  • 3′ sequencing primer TAGTGACCTGTTCGTTGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RA35 was a gift from Matthew Bennett (Addgene plasmid # 141126 ; http://n2t.net/addgene:141126 ; RRID:Addgene_141126)
  • For your References section:

    Majority sensing in synthetic microbial consortia. Alnahhas RN, Sadeghpour M, Chen Y, Frey AA, Ott W, Josic K, Bennett MR. Nat Commun. 2020 Jul 21;11(1):3659. doi: 10.1038/s41467-020-17475-z. 10.1038/s41467-020-17475-z PubMed 32694598