Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

C332
(Plasmid #141124)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141124 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 2729
  • Total vector size (bp) 3392
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CinI
  • Insert Size (bp)
    663
  • Entrez Gene
    cinI (a.k.a. RL3378, raiI)
  • Promoter engineered lac promoter
  • Tag / Fusion Protein
    • ssrA degradation tag (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTGCGCTCGAGCTTCCC
  • 3′ sequencing primer GATCAGTTGGAAGAATTTGTCCACT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    C332 was a gift from Matthew Bennett (Addgene plasmid # 141124 ; http://n2t.net/addgene:141124 ; RRID:Addgene_141124)
  • For your References section:

    Majority sensing in synthetic microbial consortia. Alnahhas RN, Sadeghpour M, Chen Y, Frey AA, Ott W, Josic K, Bennett MR. Nat Commun. 2020 Jul 21;11(1):3659. doi: 10.1038/s41467-020-17475-z. 10.1038/s41467-020-17475-z PubMed 32694598