Skip to main content
Addgene

fru-T2A-QF2 HDR plasmid
(Plasmid #141099)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141099 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC57
  • Vector type
    donor template

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    fru-left-HDR-arm; T2A-QF2-hsp70; 3xP3-dsRed-SV40; fru-right-HDR-arm
  • Species
    Synthetic; Neurospora crassa, Discosoma sp., Aedes aegypti
  • Insert Size (bp)
    2569

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTCATTATTATTGGTACCGGAATG
  • 3′ sequencing primer GGCTTCGCCACTGTTTGCC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    QF2 was obtained from Chris Potter (e.g. Addgene plasmid #104876)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fru-T2A-QF2 HDR plasmid was a gift from Leslie Vosshall (Addgene plasmid # 141099 ; http://n2t.net/addgene:141099 ; RRID:Addgene_141099)

  • For your References section:

    Fruitless mutant male mosquitoes gain attraction to human odor. Basrur NS, De Obaldia ME, Morita T, Herre M, von Heynitz RK, Tsitohay YN, Vosshall LB. Elife. 2020 Dec 7;9. pii: 63982. doi: 10.7554/eLife.63982. 10.7554/eLife.63982 PubMed 33284111
Related items: