Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Antares-SEPLuc C1A4E
(Plasmid #141088)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141088 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 9169
  • Modifications to backbone
    Neomycin deleted
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Antares-T2A-puromycin-IRESv24-SEP-C1A4E
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    4563
  • Mutation
    Please see depositor comments
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 forward (TTAATACGACTCACTATAGGG)
  • 3′ sequencing primer BGH reverse (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene cannot confirm the NLuc element of Antares but the depositor confirms that this plasmid is one of the iterations of pHLuc and it is functional.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Antares-SEPLuc C1A4E was a gift from Jeak Ling Ding (Addgene plasmid # 141088 ; http://n2t.net/addgene:141088 ; RRID:Addgene_141088)
  • For your References section:

    pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886