Antares-SEPLuc C1A4E
(Plasmid #141088)

• Purpose: precursor of the bioluminescent reporter pHluc, for detecting extracellular pH changes in tumor acidosis; utilizes weaker mutant of IRES and weaker precursor of Nanoluc
• Depositing Lab: Jeak Ling Ding
• Publication: Ong et al Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020.

Backbone

• Vector backbone: pCDNA3.1
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 4606
• Total vector size (bp): 9169
• Modifications to backbone: Neomycin deleted
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Antares-T2A-puromycin-IRESv24-SEP-C1A4E
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 4563
• Mutation: Please see depositor comments
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7 forward (TTAATACGACTCACTATAGGG)
• 3′ sequencing primer: BGH reverse (TAGAAGGCACAGTCGAGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene cannot confirm the NLuc element of Antares but the depositor confirms that this plasmid is one of the iterations of pHLuc and it is functional.