Antares-SEPLuc
(Plasmid #141086)

• Purpose: precursor of the bioluminescent reporter pHluc, for detecting extracellular pH changes in tumor acidosis
• Depositing Lab: Jeak Ling Ding
• Publication: Ong et al Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020.

Backbone

• Vector backbone: pCDNA3.1
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 4606
• Total vector size (bp): 9178
• Modifications to backbone: Neomycin deleted
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Antares-T2A-puromycin-EMCV IRES-SEPLuc
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 4572
• Mutation: Deletion of amino acids 66 to 91 on the Luciferase region (Please see depositor comments)
• Promoter: CMV

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: T7 forward (TTAATACGACTCACTATAGGG)
• 3′ sequencing primer: BGH reverse (TAGAAGGCACAGTCGAGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Deletion in the luciferase does not affect the BRET efficiency of Antares