SEP-Nanoluc-cyOFP1
(Plasmid #141082)

• Purpose: prototype of the bioluminescent reporter pHLuc, for detecting extracellular pH changes in tumor acidosis
• Depositing Lab: Jeak Ling Ding
• Publication: Ong et al Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020.

Backbone

• Vector backbone: pCDH-EF1-MCS-T2A-Puro
• Backbone manufacturer: System Biosciences (SBI)
• Backbone size w/o insert (bp): 7068
• Total vector size (bp): 9207
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SEP-Nanoluc-cyOFP1
• Species: H. sapiens (human), M. musculus (mouse)
• Insert Size (bp): 2139
• Mutation: Deletion of amino acids DISGG from positions 673 till 677 (Please see Depositor comments)
• Promoter: EF1α

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: EF1 Forward (CTCCACGCTTTGCCTGACCCTGCTT)
• 3′ sequencing primer: T2A Reverse (CGTCACCGCATGTTAGAAGACTTCCTCTGC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • NanoLuc Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Depositor confirmed that this deletion does not affect the fluorescent expression of cyOFP1.