Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEMS2155
(Plasmid #141065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141065 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pEMS2157
  • Backbone manufacturer
    Simpson lab (deposited at Addgene)
  • Modifications to backbone
    addition of SYN1 promoter
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    SURE cells
  • Growth instructions
    “SURE” cells from Agilent, that the colonies are freshly picked, and the you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SYN1-EmGFP-WPRE
  • Alt name
    Human Synapsin 1 Promoter - Emerald GFP - Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2625
  • Promoter human Synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer oEMS6098 (GCCATGCTCTAGGAAGATCG)
  • 3′ sequencing primer oEMS6126 (TCTCAGGCACGACACGACTC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

DNA synthesized at GenScript

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEMS2155 was a gift from Elizabeth Simpson (Addgene plasmid # 141065 ; http://n2t.net/addgene:141065 ; RRID:Addgene_141065)
  • For your References section:

    Intracerebroventricular Administration of AAV9-PHP.B SYN1-EmGFP Induces Widespread Transgene Expression in the Mouse and Monkey CNS. Galvan A, Petkau TL, Hill AM, Korecki AJ, Lu G, Choi D, Rahman K, Simpson E, Leavitt BR, Smith Y. Hum Gene Ther. 2021 Apr 16. doi: 10.1089/hum.2020.301. 10.1089/hum.2020.301 PubMed 33860682