pcDNA5/FRT/TO-GAlphai2-RLuc8
(Plasmid #140974)

• Purpose: Encodes a G alpha subunit (GNAI2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociation
• Depositing Lab: Bryan Roth
• Publication: Olsen et al Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8.

Backbone

• Vector backbone: pcDNA5/FRT/TO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5203
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GAlphai2-Rluc8
• Alt name: GNAI2
• Species: H. sapiens (human)
• Insert Size (bp): 2037
• Mutation: RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 91 of the alpha subunit
• Entrez Gene: GNAI2 (a.k.a. GIP, GNAI2B, HG1C, H_LUCA15.1, H_LUCA16.1)
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.