Skip to main content
Addgene

pCAG-AviMta2-3xFiBsd
(Plasmid #140964)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140964 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG-A3XFiBsd
  • Backbone manufacturer
    Hendrich Lab
  • Backbone size w/o insert (bp) 6348
  • Total vector size (bp) 7860
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    metastasis-associated gene family, member 2
  • Alt name
    MTA2
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_011842.3
  • Entrez Gene
    Mta2 (a.k.a. AW550797, Mata1l1, Mta1l1, mmta2)
  • Promoter CAG
  • Tags / Fusion Proteins
    • Avi (N terminal on backbone)
    • TEV (N terminal on backbone)
    • 3xFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcaacgtgctggttattgtgctg
  • 3′ sequencing primer gagaggggcggaattcgatatcaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-AviMta2-3xFiBsd was a gift from Brian Hendrich (Addgene plasmid # 140964 ; http://n2t.net/addgene:140964 ; RRID:Addgene_140964)
  • For your References section:

    The Nucleosome Remodelling and Deacetylation complex suppresses transcriptional noise during lineage commitment. Burgold T, Barber M, Kloet S, Cramard J, Gharbi S, Floyd R, Kinoshita M, Ralser M, Vermeulen M, Reynolds N, Dietmann S, Hendrich B. EMBO J. 2019 Jun 17;38(12). pii: embj.2018100788. doi: 10.15252/embj.2018100788. Epub 2019 Apr 29. 10.15252/embj.2018100788 PubMed 31036553