pET11-His6-Pif6-sfGFP-ssrA
(Plasmid
#140891)
-
PurposeExpression of PIF-sfGFP-ssrA in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET11a
-
Backbone manufacturerNovagen
- Total vector size (bp) 6751
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePIF-sfGFP-ssrA
-
SpeciesSynthetic
-
Insert Size (bp)1110
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggtgatgtcggcgatatag
- 3′ sequencing primer tgctagttattgctcagcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET11-His6-Pif6-sfGFP-ssrA was a gift from Neal Devaraj (Addgene plasmid # 140891 ; http://n2t.net/addgene:140891 ; RRID:Addgene_140891) -
For your References section:
Lipid sponge droplets as programmable synthetic organelles. Bhattacharya A, Niederholtmeyer H, Podolsky KA, Bhattacharya R, Song JJ, Brea RJ, Tsai CH, Sinha SK, Devaraj NK. Proc Natl Acad Sci U S A. 2020 Aug 4;117(31):18206-18215. doi: 10.1073/pnas.2004408117. Epub 2020 Jul 21. 10.1073/pnas.2004408117 PubMed 32694212