Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTNT-pT7-tetR-mCherry
(Plasmid #140870)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140870 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTNT
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 4215
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TetR-mCherry expressed with T7 promoter
  • Species
    Synthetic
  • Insert Size (bp)
    1400
  • Promoter T7
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tatggaaaaacgccagcaac
  • 3′ sequencing primer gctgcgcaactgttgggaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTNT-pT7-tetR-mCherry was a gift from Neal Devaraj (Addgene plasmid # 140870 ; http://n2t.net/addgene:140870 ; RRID:Addgene_140870)
  • For your References section:

    Communication and quorum sensing in non-living mimics of eukaryotic cells. Niederholtmeyer H, Chaggan C, Devaraj NK. Nat Commun. 2018 Nov 28;9(1):5027. doi: 10.1038/s41467-018-07473-7. 10.1038/s41467-018-07473-7 PubMed 30487584