pTNT-pT7-tetR-sfGFP
(Plasmid
#140868)
-
PurposeT7 promoter driven synthesis of C-terminal fusion of sfGFP to TetR repressor (TetR-sfGFP)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTNT
-
Backbone manufacturerPromega
- Total vector size (bp) 4221
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTetR-sfGFP expressed with T7 promoter
-
SpeciesSynthetic
-
Insert Size (bp)1430
- Promoter T7
-
Tag
/ Fusion Protein
- sfGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tatggaaaaacgccagcaac
- 3′ sequencing primer gctgcgcaactgttgggaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTNT-pT7-tetR-sfGFP was a gift from Neal Devaraj (Addgene plasmid # 140868 ; http://n2t.net/addgene:140868 ; RRID:Addgene_140868) -
For your References section:
Communication and quorum sensing in non-living mimics of eukaryotic cells. Niederholtmeyer H, Chaggan C, Devaraj NK. Nat Commun. 2018 Nov 28;9(1):5027. doi: 10.1038/s41467-018-07473-7. 10.1038/s41467-018-07473-7 PubMed 30487584