Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET263-pUC57 24xMS2V7
(Plasmid #140705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140705 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC57
  • Backbone manufacturer
    Genescript
  • Backbone size w/o insert (bp) 2749
  • Total vector size (bp) 4177
  • Modifications to backbone
    None
  • Vector type
    Cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    24xMS2V7
  • Alt name
    24 MS2 loops
  • Species
    Synthetic
  • Insert Size (bp)
    1428
  • Mutation
    24 MS2 loops V7, high-affinity C-variant, inter-spaced by 41 nucleotide linkers, no stop codons in the 3 reading frames.
  • Promoter None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET263-pUC57 24xMS2V7 was a gift from Robert Singer & Evelina Tutucci (Addgene plasmid # 140705 ; http://n2t.net/addgene:140705 ; RRID:Addgene_140705)
  • For your References section:

    An improved MS2 system for accurate reporting of the mRNA life cycle. Tutucci E, Vera M, Biswas J, Garcia J, Parker R, Singer RH. Nat Methods. 2017 Nov 13. doi: 10.1038/nmeth.4502. 10.1038/nmeth.4502 PubMed 29131164