pET263-pUC57 24xMS2V7
(Plasmid #140705)

• Purpose: MS2V7 cloning
• Depositing Labs: Robert Singer, Evelina Tutucci
• Publication: Tutucci et al Nat Methods. 2017 Nov 13. doi: 10.1038/nmeth.4502.

Backbone

• Vector backbone: pUC57
• Backbone manufacturer: Genescript
• Backbone size w/o insert (bp): 2749
• Total vector size (bp): 4177
• Modifications to backbone: None
• Vector type: Cloning vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 24xMS2V7
• Alt name: 24 MS2 loops
• Species: Synthetic
• Insert Size (bp): 1428
• Mutation: 24 MS2 loops V7, high-affinity C-variant, inter-spaced by 41 nucleotide linkers, no stop codons in the 3 reading frames.
• Promoter: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: CAGGAAACAGCTATGACCATG

Resource Information

• Supplemental Documents:
  • Annotated plasmid map
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry