pLX-TRE-dCas9-KRAB-MeCP2-BSD
(Plasmid #140690)

• Purpose: Inducible knockdown of gene expression in human cells for pooled scRNA-seq experiments
• Depositing Lab: Andrea Califano
• Publication: Tan et al bioRxiv 2021.06.28.449297

Backbone

• Vector backbone: PB-TRE-dCas9-KRAB-MeCP2
• Backbone manufacturer: Andrea Califano
• Total vector size (bp): 16734
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cas9m4-KRAB-MeCP2
• Species: Synthetic

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCCCAAATTCTCGATTCACGC
• 3′ sequencing primer: CTCGGTGGGGTATCGACAGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Chavez et al Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a lentiviral vector (modified in #122205; originally from Weissman lab #85969) with a Tet-ON 3G dCas9m4-KRAB-MeCP2 (Church lab; #63800). Note: the vector has been modified to use blasticidin selection.