BRD4-N CRISPR
(Plasmid
#140651)
-
PurposeBRD4 tagging CRISPR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140651 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRD4
-
gRNA/shRNA sequenceATGTCTGCGGAGAGCGGCCC
-
SpeciesH. sapiens (human)
-
Entrez GeneBRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BRD4-N CRISPR was a gift from Masato Kanemaki (Addgene plasmid # 140651 ; http://n2t.net/addgene:140651 ; RRID:Addgene_140651) -
For your References section:
The auxin-inducible degron 2 technology provides sharp degradation control in yeast, mammalian cells, and mice. Yesbolatova A, Saito Y, Kitamoto N, Makino-Itou H, Ajima R, Nakano R, Nakaoka H, Fukui K, Gamo K, Tominari Y, Takeuchi H, Saga Y, Hayashi KI, Kanemaki MT. Nat Commun. 2020 Nov 11;11(1):5701. doi: 10.1038/s41467-020-19532-z. 10.1038/s41467-020-19532-z PubMed 33177522