pQCascade-IS186
(Plasmid
#140627)
-
PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDFDuet-1
-
Vector typeBacterial Expression, CRISPR ; Transposon
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
-
gRNA/shRNA sequencetggatgctttgcgtgcaaaggaacctgaactc
-
SpeciesVibrio cholera
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
An unexpected 65 bp insertion was detected in the origin of replication, comparing to the sequence of the backbone plasmid pCDFDuet-1. But, the plasmid has been proven to work normally.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCascade-IS186 was a gift from Sheng Yang (Addgene plasmid # 140627 ; http://n2t.net/addgene:140627 ; RRID:Addgene_140627) -
For your References section:
Multicopy chromosomal integration using CRISPR-associated transposases. Zhang Y, Sun X, Wang Q, Xu J, Dong F, Yang S, Yang J, Zhang Z, Qian Y, Chen J, Zhang J, Liu Y, Tao R, Jiang Y, Yang J, Yang S. ACS Synth Biol. 2020 Jun 17. doi: 10.1021/acssynbio.0c00073. 10.1021/acssynbio.0c00073 PubMed 32551502