pQCascade
(Plasmid #140622)

• Purpose: Expresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and CRISPR RNA
• Depositing Lab: Sheng Yang
• Publication: Zhang et al ACS Synth Biol. 2020 Jun 17. doi: 10.1021/acssynbio.0c00073.

Backbone

• Vector backbone: pCDFDuet-1
• Vector type: Bacterial Expression, CRISPR ; Transposon

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: VchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(entry)
• gRNA/shRNA sequence: caattcccctgtagaaataattttg
• Species: Vibrio cholera

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)

Resource Information

• Supplemental Documents:
  • pQCascade.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

An unexpected 65 bp insertion was detected in the origin of replication, compared to the sequence of the backbone plasmid pCDFDuet-1. But, the plasmid has been proven to work normally.